Part:BBa_K3683000

Cell culture

HEK293T cells and ACE2-293T cells (cells transfected with human ACE2) were purchased from ProCell (Wuhan, China), 293T cells were maintained in Dulbecco’s Modified Eagle Medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS; Gibco, Rockville, MD, USA), 100 mg/mL of streptomycin, and 100 unit/mL of penicillin at 37 °C in 5% CO2. HEK293T cells transfected with human ACE2 (293T-ACE2) were cultured under the same conditions with the addition of G418 (0.5 mg/mL) to the medium.

Serum sample (harvested at Day 35 post vaccination by an RBD vaccine was used for infectivity inhibition experiment. Detailed information is provided by Yang et al, Nature 2020 and was a kindly gift from Dr. Jingyun Yang (West China Hospital, Sichuan University).

Production and titration of SARS-CoV-2 S pseudoviruses

We generated either wild type SARS-CoV-2 S or S-D614G variant pseudotyped virus with a luciferase reporter using an HIV-1 backbone. Specifically, 5x106 HEK293T cells in 100mm dish were co-transfected with 12 ug pLOVE-luciferase-EGFP plasmid, 6 ug psPAX2 and 2 ug recombinant SARS-CoV-2 S plasmids or SARS-CoV-2 S-D614G plasmid. Transfection was done using the lipofectamine 3000 transfection reagent (Invitrogen) according to the manufacturer’s instructions. (A: 1ml OPTI-DMEM + 40 ul lipofectamine 3000; B: 1ml OPTI-DMEM + 40 ul P3000 + Plasmids; Mix A and B, incubate 15 min at R.T., then add the Mix into culture dish). The medium for transfected cells were replaced by a fresh Medium (10 ml) ~8 h later. The supernatant containing SARS-CoV-2 pseudoviruses were harvested at 48 h and 72 h after the initial transfection and filtered through a 0.45 um filter. Pseudoviruses were concentrated by a centrifugal ultrafiltration device, we then used 50 ul medium to dissolve viruses for one package. Titration of pseudoviruses by qRT-PCR using TransLvTM Lentivirus qPCR Titration Kit (FV201, Transgen).

Psuedovirus infection and neutralization assays

2x104 ACE2-293T cells were seeded into 96-well plates.

For an infection assay, 50 ul medium containing serial dilutions (1:1, 1:2, 1:4, 1:8, 1:16) of pseudoviruses (~ 6.4× 105 vg) was were added to the 96-well containing ACE2-293T cells. After 12 h of infection, fresh culture medium was added to each well. Luciferase activity was measured 48 h after infection using ONE-GloTM Luciferase Assay System (E6120, Promega).

For a neutralization assay, 50 ul medium containing pseudoviruses (~4x104 vg) were incubated with media or with serially diluted sera from immunized with an RBD vaccine (from 1:1000 to 1:102400) for 1 h at 37℃, then added to the 96-well plates containing ACE2-293T cells. After 12 h of infection, fresh culture medium was added to each well. Luciferase activity was measured 48 h after infection using ONE-GloTM Luciferase Assay System (E6120, Promega).

Authentic virus neutralization assay

100 ul medium containing authentic wild type SARS-COV-2 virus or D614G mutant SARS-COV-2 virus were incubated with media or with serially diluted rRBD-15 antibody (from 1:200 to 1:25600) for 1 h at 37℃, then added to the 96-well plates that were pre-seeded with Vero E6 cells (5×104) and grown overnight. After 12 h of infection, fresh culture medium was added to each well. RNA of each well’s Vero E6 cells were extracted and reverse-transcripted by Prefill Viral Total NA Kit (thermo KFRPF-805296) 48 hours later, and viral genomic RNA (gRNA) and viral subgenomic RNA (sgRNA, indicative of viral replication) were quantitatively detected by digital PCR. Neutralization activity were calculated by dividing gRNA or sgRNA copy number of rRBD-15 wells to that of non-antibody wells. Meanwhile, 197 serum of COVID-19 patients’ neutralization activity to authentic SARS-COV-2 virus were examined in this same way.

Results

Generation of pseudovirus

We cloned the full length S gene S-FL into a pCAGGS vector and generate a wild type S pseudovirus (pCAGGS-S). We evaluate the efficacy of virus packaging and production of the S-FL (full length). We found that the efficacy of virus packaging and production was very low. We then engineered a deletion mutant S1254 with a c-terminal 19 amino acid deletion (from 1255-1273, Fig 1a) and found S1254 had a much higher packaging efficacy titer (3.3E+04 in S-FL, 2.7 E+05 in S1254, Fig 1b). Therefore, we used the S1254 construct representing the wild type S and engineered S-D614G variant so S1254 was used in all subsequent experiments,. Then Based on the pCAGGS-S1254 plasmid, we generated S-D614G variant construct by PCR-based direct mutagenesis using a pair of corresponding primers listed in Materials and methods. We obtained the exact right size product (Fig1c),

and purified the exact size of S-D614G PCR product by gel extraction, then we used Exnase II (C214, Vazyme) to digest uncirclized plasmid so the remaining PCR products were circled. Then circled S variant S-D614G plasmids were transformed into DH5α competent cells, single clones were select to grow recombinant plasmids in culture (Fig 2a) and correct clones were verified by by Sanger DNA sequencing (Fig 2b).

We then packaged pseudovirus by transfection 293T cells using either pCAGGS S, psPAX2, and pLOVE-Luc.-GFP for the S, or pCAGGS S-D614G , psPAX2, and pLOVE-Luc.-GFP for the S-D614G variant. Using GFP green fluorescence in the pLOVE-Luc.-GFP vector, we were able to observe a high transfection efficiency of packaged pseudovirus (Figure 3)

Infectivity and neutralization assays

We applied different amounts of pseudovirus to infect the ACE2-293T cells and quantified corresponding luciferase activities. The result showed that S-D614G was more infective compared to S pseudovirus by exhibiting more green fluorescence (Figure 4a) and higher levels of luciferase activities (Fig. 4b). Next, we performed a neutralization assay in a 96-well cell culture plate, we evaluated the neutralizing activity of a monkey serum sample vaccinated from a RBD protein against S and S-D614G pseudovirus (Fig 5a). A luciferase assay result showed that antibodies in the serum from a monkey vaccinated with an RBD protein exhibit about slightly neutralizing titers against S-D614G than S (Figure 5b)

Conclusion

We engineered a pseudovirus assay expressing S and D614G variants and a dual GFP-luciferase reporter system. We show a dose dependent infection curve and higher infectivity by G614D variant. We further assessed the ability of neutralization of infection by antibodies from a monkey serum sample vaccinated by an RBD vaccine. We show antibodies effectively block the interactions between the RBD of S protein and the ACE2 receptors of the original S strain as well as the predominant strain D614G, suggesting a vaccine made against original Wuhan virus can be effective against the mutated, more infectious G614D strain. Our engineered pseodoviruse system provides a universal platform for infectivity and immunity evaluation on SARS-CoV-2.

Characterization by 2021iGEM_Shanghai_HS

Improvement of an existing part

1. We have successfully optimized the protein expression sequence Compared to the old part BBa_K3683000(Part:BBa K3683000 - parts.igem.org) we design a new part BBa_K3916005, both can express S1&RBD protein. The sequence of 1485bp between the two genes is duplicate, and the rest is different, proving that we have optimized the existing gene sequence, providing a variety of gene expression ideas that may make a big difference to functions.

Figure 8. The blast results about the sequence of our new part BBa_K3916005 and the old one BBa_K3683000..

2. We screened out antibodies with high inhibition activity, which proved the effectiveness of our expression vectors. Our results highlighted again the importance of epitope outside or on the verge of RBD/ACE2 interface and would facilitate future endeavors searching for broad-spectrum anti-coronavirus approaches. Overall, we presented evidence that 3E8 is a promising therapeutic candidate for the coronavirus pandemic and believe that it represents a significant conceptual advance in fighting COVID-19, which keeps evolving and may open the door for more ACE2-targeting drug discovery and development.

Figure 9. 3E8 blocked the bindings of recombinant S1 or RBD from multiple coronaviruses and the mutant variants of SARS-CoV-2 to His-tagged recombinant human ACE2 protein: (A-E) Bindings of recombinant S1 or RBD (in D only) from different coronaviruses and SARS-CoV-2 mutated variants to recombinant human ACE2 protein were blocked by 3E8. (F) The IC50 values of 3E8 in blocking S1 or RBD binding to human ACE2 protein..

We proposed a new antibody, proteins that can target and block the ACE2 receptor. We got the antibody 3E8 which was screened out from plenty of antibodies and was able to target and the ACE2 receptor. Consequently, mutation type as the virus is, the antibody 3E8 will effectively block the virus entry due to the close of the “door”.

PTT5-S1-his-B.1.1.7

Usage and Biology

The S glycoprotein is the immunodominant target for previous NAbs, and comprises an N-terminal domain (NTD), a receptor-binding domain (RBD/S1B), and an S2 subunit. The SARS-CoV RBD [amino acids (aa) 338–506] consists of an S1B core domain (S1BCD) (aa 318–424) and a receptor-binding motif (RBM) (aa 438–498) that directly engages the human receptor hACE2. Meanwhile, The RBD is also a significant neutralization determinant in the inactivated SARS-CoV vaccine because it induces potent NAbs that block SARS-CoV entry.

Construct design

We aimed to construct the plasmid to give the protein (S1&RBD) synthesized from B138 the ability to perform the protein purification and ELISA testing as well as to mimic the property held by the spike protein of the coronavirus.

Figure 1. Map of pTT5-S1-his-B117 expression plasmids..

The profiles of every basic part are as follows:

BBa_K3916000

Usage and Biology

pTT5（BBa_K3916000） is a mammalian expression vector with 4401bp, which itself has ampicillin resistance. Promoter is CMV，Primers for 5'sequencing: CMV-F:CGCAAATGGGCGGTAGGCGTG; Primers for 3'sequencing: based on sequence design. In this project, we created two plasmids(pTT5-S1 &pTT5-RBD) using the pTT5 backbone to benefit our project as well as any group wishing to conduct coronavirus research. This is important because it provides other researchers intending to study coronaviruses with tools (plasmids) for further research, thus saving steps, materials and time.

Figure 2. Plasmid Map of pTT5..

BBa_K3916004

Usage and Biology

BBa_K3916004 is the coding sequence of a kind of protein (RBD). Coronavirus pneumonia (Coronavirus disease 2019, COVID-19) infects the human body with pneumonia caused by the combination of S protein on its surface with angiotensin-converting enzyme 2 (ACE2) receptors. Mutations in the S1 protein in the S protein and its receptor binding domain (RBD) can lead to changes in viral infection capacity and may lead to immune escape. The RBD is also a significant neutralization determinant in the inactivated SARS-CoV vaccine because it induces potent NAbs that block SARS-CoV entry. In this project, we aimed to construct a plasmid to give the protein of RBD synthesized from B138 the ability to perform the protein purification and ELISA testing as well as to mimic the property held by the spike protein of the coronavirus.

BBa_K3916001

Usage and Biology

The coronavirus genome is comprised of ∼30000 nucleotides. It encodes four structural proteins, Nucleocapsid (N) protein, Membrane (M) protein, Spike (S) protein and Envelop (E) protein and several non-structural proteins. COVID-19 is caused by the novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). SARS-CoV-2 infection may be asymptomatic or it may cause a wide spectrum of symptoms, such as mild symptoms of upper respiratory tract infection and life-threatening sepsis.

The S glycoprotein is the immunodominant target for previous NAbs, and comprises an N-terminal domain (NTD), a receptor-binding domain (RBD/S1B), and an S2 subunit. The SARS-CoV RBD [amino acids (aa) 338–506] consists of an S1B core domain (S1BCD) (aa 318–424) and a receptor-binding motif (RBM) (aa 438–498) that directly engages the human receptor hACE2. Meanwhile, The RBD is also a significant neutralization determinant in the inactivated SARS-CoV vaccine because it induces potent NAbs that block SARS-CoV entry.

Experimental approach

We constructed the plasmid (BBa_K3916006) then used the method of PCR to replicate the fragment of RBD-800 bp. Moreover, we did enzyme cutting then homologous recombination. Finally we could extract the plasmid for subsequent experiment.

Figure 3. DNA electrophoresis gel..

Electrophoresis is designed to verify the genetic success of our purpose (RBD). We can find this is successful. Purification of protein

Remove DH5α receptor cells from -80°C and place on ice to melt. Add 20 μl of recombinant plasmid product to the strain, flick the wall of the tube, place on ice for 30 min, heat excites in a water bath at 42°C for 45 s, and then place on ice for 2 min to cool. Add 1000μl LB medium (without antibiotics), shake at 37°C, 220 rpm, and incubate for 60 min. Centrifuge at 5000 rpm for 5 min at room temperature, discard 900 μl supernatant and mix the remaining medium and cells by blowing. Take 100μl of bacterial solution evenly coated on pre-warmed ampicillin-resistant (Amp+) plates and incubated overnight at 37℃ in an inverted incubator; The next day picks monoclonal colonies in 20μl LB liquid medium and take 2μl for PCR sequencing of the bacterial broth to confirm successful recombination. The remaining 18μl was added to 1ml Amp+ LB and incubated for 6-8 hours at 37℃ in the shaker, 220rpm.

Figure 4. SDS-PAGE Gel..

We reconstruct the plasmid then use the method of PCR to replicate both fragment of S1-2000 bp and RBD-800 bp.

Proof of function

The fast-evolving of coronaviruses, such as SARS-CoV-2, makes broad-spectrum coronavirus preventional or therapeutical strategies highly sought after. Our results highlighted again the importance of epitope outside or on the verge of RBD/ACE2 interface and would facilitate future endeavors searching for broad-spectrum anti-coronavirus approaches. Overall, we presented evidence that 3E8 is a promising therapeutic candidate for the coronavirus pandemic and believe that it represents a significant conceptual advance in fighting COVID-19, which keeps evolving and may open the door for more ACE2-targeting drug discovery and development.

1.3E8 Binds Human ACE2 With Moderate Affinity

Figure 5. Monoclonal antibody 3E8 and recombinant S1-subunits or RBD from different coronaviruses (and SARS-CoV-2 mutant variants) bound to His-tagged recombinant human ACE2 protein: (A) Binding of 3E8 to His-tagged recombinant human ACE2 protein as measured by ELISA; (B) Binding of 3E8 to His-tagged human ACE2 as measured by BLI; (C-G) Bindings of recombinant S1-subunits or RBD (in F only) from multiple coronaviruses and SARS-CoV-2 mutated variants to recombinant human ACE2 protein as measured by ELISA; (H) The EC50 values of recombinant S1-subunit bindings to human ACE2..

We measured the binding affinity of 3E8 to His-tagged human ACE2 protein with ELISA and biolayer interferometry (BLI). The EC50 value was 15.3 nM in ELISA (Fig. 5A) and the dissociation constant (KD) was 30.5 nM in BLI (Fig. 5B). It is also bound to HEK293F cells ectopically overexpressing human ACE2 and to Vero E6 cells endogenously expressing human ACE2, as demonstrated by flow cytometry (Fig. S1E).

2. 3E8 Blocks The Bindings Of S1-Subunits Or RBD From Multiple Coronaviruses To ACE2

We investigated the abilities of 3E8 to block the ACE2 binding of S1-subunits or RBD from SARS-CoV-2, SARS-CoV-2-D614G, B.1.1.7, B.1.351, B.1.617, P.1, SARS-CoV and HCoV-NL63. These S1-subunits or RBD can all bind to His-tagged human ACE2 molecules (Fig. 5C-G), and the EC50 values to His-tagged recombinant human ACE2 molecule were 11.8, 2.6, 0.8, 6.9, 51.3, 14.9, 1.1 and 24.2 nM, respectively (Fig. 5H).

Figure 6. 3E8 blocked the bindings of recombinant S1 or RBD from multiple coronaviruses and the mutant variants of SARS-CoV-2 to His-tagged recombinant human ACE2 protein: (A-E) Bindings of recombinant S1 or RBD (in D only) from different coronaviruses and SARS-CoV-2 mutated variants to recombinant human ACE2 protein were blocked by 3E8. (F) The IC50 values of 3E8 in blocking S1 or RBD binding to human ACE2 protein..

Incubation with 3E8 effectively blocked all S1-subunits or RBD binding to ACE2 (Fig. 6A-E) and the IC50 values were 7.1, 13.8, 10.0, 3.7, 10.5, 9.3, 13.7 and 5.0 nM, respectively (Fig. 6F). Thus, 3E8 can broadly block the binding of S1-subunits or RBD from multiple coronaviruses, including the fast-spreading SARS-CoV-2 variants, to human ACE2 molecules.

3. 3E8 Abolishes The Infectivity Of Multiple Pseudo-Typed Coronaviruses

Figure 7. 3E8 blocked the infection of ACE2-expressing cells by multiple pseudo-typed coronavirus constructs. ACE2-Fc and B38 were used as positive controls, and human IgG4 isotype was negative control. (A-G) 3E8 blocked the infection of ACE2-overexpressing HEK293 cells by different pseudo-typed coronavirus constructed with Env-defective HIV-1 and full-length S-proteins from SARS-CoV-2, SARS-CoV-2-D614G, B.1.1.7, B.1.351, B.1.617, SARS-CoV and HCoV-NL63. (H) The IC50 values of 3E8 in blocking pseudo-typed coronaviruses..

We next constructed pseudo-typed coronaviruses with full-length S-proteins from SARS-CoV-2, SARS-CoV-2-D614G, B.1.1.7, B.1.351, B.1.617, SARS-CoV and HCoV-NL63 (Fig. 7A-G). All pseudoviruses could infect HEK293F cells that ectopically express human ACE2, while SARS-CoV-2-D614G showed significantly enhanced infectivity when compared to the original SARS-CoV-2 (Fig. S2). Incubation with 3E8 fully abolished the infectivity of all pseudoviruses, with IC50 values at 0.1, 0.1, 0.07, 0.3, 0.08, 0.2 and 1.1 nM, respectively (Fig. 7H). In comparison, B38, a SARS-CoV-2 RBD-targeting antibody currently under clinical development, could only suppress the infectivity of SARS-CoV-2, SARS-CoV-2-D614G, B.1.1.7 and B.1.617, but not B.1.351, SARS-CoV or HCoV-NL63. The suppression of 3E8 was not only broader but also remarkably more efficacious and potent, as the IC50 values of 3E8 were hundreds of folds improved when compared to that of B38 (Fig. 7H). The ACE2-Fc fusion protein, a virus RBD-targeting molecule consisting of the extracellular domain of human ACE2 and the Fc region of human IgG1, showed broad but mediocre blocking ability on pseudoviruses. Our investigation indicated that 3E8 is potentially a powerful and broad-spectrum blocker on coronaviruses that are dependent on ACE2.